Post/Author/DateTime	Post
Aseran 07-29-07, 04:53 AM	Pardon me if this comes up a lot. But, I'm running a D&D game, and the action has shifted primarily to the Outer Planes (based largely in Sigil, of course) and an enemy of the PCs has taken to using Yugoloth mercenaries against them. I'm coming to realize, though, that I'm not sure how to get them to come across right. Demons and Devils are, generally, easy to figure out how to roleplay because they tend to have generally predetermined outlooks, but Yugoloths are weird. How should I portray them so the PCs percieve them as unique beings rather than "typical" monsters? So far, they've only run into Mezzoloth thugs (and Canoloth fodder), but I want to up the ante as time goes on, and the "hired muscle" approach doesn't seem right to apply to Nycaloths, Arcanoloths, and worse. I don't have any of the old Planescape resources concerning them (those being Hellbound and Faces of Evil), otherwise I probably wouldn't be so much asking.
Optimator 07-29-07, 07:41 AM	Whenever I have to RP them, I think, "Okay, there's a plan, but ME ME ME ME ME US ME ME ME!". I dunno if that will help, but there it is.
DwarfPcfan 07-29-07, 10:51 AM	I base my Yuggoloths on a comic book characters: Death Stroke Just to use one of his quotes from Infinite Crisis: " Sorry Babe, it's just business"
HighPriestMikhal 07-29-07, 12:13 PM	Yugoloths don't get enough attention in 3e, IMO. Generally, they have plans but are willing to change or abandon them if something better comes along. How they corrupt mortals isn't as important so much as they corrupt them to begin with. They serve any power willing to pay their fees, but aren't above switching sides if a better offer comes along. In a fight, they'll stay until it's clear they're in danger and then they'll just abandon their comrades. So long as it serves their personal interests or is profitable to them, they'll stay with someone or at something. But when it's not profitable, they'll let go at the drop of a feather unless they have some sort of personal motivation to keep at it.
rivaltuna 07-29-07, 03:17 PM	However you want to. Personally, I RP'd Mephistopheles as a cool, calm, and collected gentleman that was more LN than LE. But he did show his LE side when he gave a tip to an Eryine that was standing guard with a delayed blast fireball taped to the underside of the platinum piece, and grinned as he escorted them through the gates of Cania. The way I play fiends with an agenda is basically: LN, but with bits of evil showing through occasionally, but regularly. If you keep them calm, they won't fry you on the spot, as they are not CE, but they will manipulate you into doing what is in their buisness. And in turn, you can use that to your advantage by making their best interest your best interest. Get it? Unless their over the top, totally evil. Then RP them as like, Emporer Palpatine or somthing.
moscatabaco76 07-29-07, 03:51 PM	As most people have said, Yugoloths should be portrayed as double crossing mercenaries. The least powerful ones ought to be toadying cowards that will backstab you the moment they have a chance; will overcompensate by bullying anyone they can, and will sink as low as they neet to get what they want. The most powerful ones should be little better, except with more confidence, but perfectly willing to teleport away the second things get ugly. Yugoloths are honorless. A Demon might throw himself to death for pure rage and spite, and Devils would like to appear honorable and trustworthy to increase his credibility and status, and fight head on to prove his mettle and loyalty. A Daemon will ALWAYS fight dirty, and will bain the moment the arrangement doesn't suit his needs.
Ornum 07-29-07, 08:20 PM	I'm not sure that betrayal by a 'loth is a foregone conclusion. If the situation suits the 'loth in question, it may never change allegiances. They are master manipulators above all else. Even though they may act as mercenaries at times, you'll find that its the 'loths who end up pulling all the strings. IF a 'loth does betray, then it is because it is part of a larger plan set up years (or longer..centuries, possibly) only they know the dark of. IF they turn stag, it will be for no obvious gain that normal folk can possibly imagine, but something that makes sense only to them.
Bob the Efreet 07-30-07, 12:08 AM	If you have the time to look up just about anything our local Shemeska the Marauder has written, he catches the tone of 'loths wonderfully.
oracle71 07-30-07, 10:35 AM	I think of them as on a sadistic mercenary-backstabbing egomaniacal politician spectrum. The lower level of 'loths (mezzoloths, canoloths, and piscoloths), are on the sadistic mercenary end of the spectrum. The high level 'loths (arcanoloths and ultraloths) are backstabbing egomaniacal politicians, making deals that benefit themselves, manipulating the situation to benefit themselves, then betraying their "allies" when they are no longer of use to the 'loth, and when said "allies" are in no position to exact retribution. The other yugoloths are somewhere in between.
Morka 07-30-07, 10:49 AM	Decepticon's Starscream, perhaps? Obeying his master, always waiting for the opportunity to strike him in the back, all the long a killing machine...
Shemeska the Marauder 07-30-07, 11:19 AM	The lesser yugoloths will be more petty. Blunter in their violence and more direct in their evil. Greater 'loths will toy with you, corrupt you, break you simply because they can do so, even if it's not necessarily for their own benefit, but for the benefit of a greater notion of universal evil. They're paragons of selfishness that at the same time abase themselves utterly to the concept that defines them. I also try to differentiate ever so slightly between 'loths from Gehenna, the Waste, and Carceri, giving them a slight touch of Law or Chaos respectively to color their perspectives on what NE is, and the best path to advance it. And the 'loths' creators are something else entirely, and I try my best to make them each unique in their particular outlooks. But here are some examples I yoinked from some fiction: Cold. Dispassionate. Clinical. Cruel. “The more we do to you, the less you believe we're doing it.” – Dr. Joseph Mengele *** “How does it feel?” That was the first question that I asked him. The man shuddered and jerked where he stood at the edge of the bluff, looking out over the burning landscape below. The city, his city, was in ruin, the vineyards and fields but black squares of ash and smoldering verdant flesh. Cellulose, orange flame, 930 degrees, acrid caramelization of the components of the cellulose is swiftly overrun by their dissociation into organic radicals and finally naught but charcoal, wind from the west fanning the flames higher to a yellow orange glow to finish the process as the sparks turn to flame, turn to fire, turn to smoke and billow up into the mortal’s face He squinted and stumbled and I asked him again, though barely a second had passed while my observations had run their circuit of eyes to brain to pen to paper. “How does it feel?” The crackle of flame, the scream of pain, and the rage of fiends through the city faded away from the jellied meat of his skull as he turned and looked up at me. Mortal. Human. Yellow/brown skin, melanin consistent with his sphere’s inclination against its parent star. Heart rate 115 beats per minute, blood pressure rising, 140 / 90, pumping hard and fast through capillary beds in his face as their associate arterioles constrict and he pales considerably. I stood before him, backlit by the fires in the distance to the south and the collapsing gate back to Oinos. He was shorter than I, five feet ten inches compared to thirteen and seven, and so I loomed over him, throwing him into shadow. Though not perhaps obvious to those unfamiliar with him, given his emotional state, he was intelligent, highly so, and he was learned in the lore of fiends, the summoning of demons, the contractual vulgarities and vagaries of diabolism, and he’d gleaned no small bit of knowledge from a ragged copy of the Book of Keeping. He was guilty, responsible for the fires that raged across field and foundation and in Tanar’ric hearts all about. C9H13NO3 floods his bloodstream, adrenaline, he is horrified, afraid. His eyes bulge, his jaw slackens, his legs tremble, and in his brain I see the patterns of his thoughts, read his every notion as he is forming them and even before his cranial organ of flesh and possibility has given him an awareness of them in the first place I am recording them. ‘Who are you? What are you? Powers above save me!’ His mind rattles the thoughts in duplicate, triplicate, resonating from nerve to nerve, synapse to synapse firing in conjunction like battalions of archers defending their dendritic castles against any higher thought as –fear- permeates, saturates, overwhelms. I gazed down at the human and waited, my actions hinged upon his, watching, waiting, listening, and recording. He was a theurge of no specific god, but rather he was devoted to the abstracts of Xaos/Chaos/aXoS/xsOS and all other permutations of the theme. Combined with his knowledge of Wild Magic as an arcane discipline, he was a potent worker of the Art. But all things in perspective I suppose… I made no preemptory motions, I simply stood there, waiting for him to act and realize both that I was not there to rip his soul from its fleshy shell (though I could have) but also to realize the utter futility of his situation. The sooner he was convinced of either, the sooner that I would be able to question him. But ah! Violence… the refuge of the desperate, the refuge of those without options, and of those without the sense for anything grander and subtler. I watched while a pattern of arcane words flickered across the mortal’s brain. Abjuration, evocation, transmutation. He ponders all types of responses, though in truth he has no vague clue of what I am, nor what my intentions are, only seeing the towering blasphemy before him and assuming the worst given his current circumstances. ‘Shall I dismiss it? Banish it? Send it hurtling back to whatever layer of the Abyss spawned it?’ His brain churns and roils, conflicted as to its most appropriate response. ‘Flame? Ice? Disintegration? Or barring them all, I can always flee.’ The choice forms in his matrix of ganglia, blood, and neurotransmitters, action potentials blurring across their playground of warm, wet wires: ‘banishment!’ is their frenzied cry. I did nothing of course. The spell was hurled at me, quickly, expertly, and with more than a bit of skill, but alas for his hopes, it did absolutely nothing. It never had a chance frankly, as it didn’t penetrate any of my natural resistance to magic, and had it done so, it would have been snuffed by the other defenses in place about my being, to say nothing of a counterspell on my part had I felt it necessary. And had it, I’d have simply returned a moment later, none the worse off. But regardless of the hypothetical, his spell was snuffed like a rearing wave breaking against a firm seawall. Squelched, it was gone with no trace of its passing. He was not expecting me to still be present. His voice falters, he falls to his knees, and within the epithelium lining the lachrymal ducts within the meat of his face the cells respond to a cascade of information, messengers, chemicals, hormones, like biological prayers from protein to nucleic acid. At their core the helical strands separate and belch forth a sequence of information that as with all I dutifully record. The biological rutting of mortal matter within his body is a chorus of screams and whimpers to me, as I see it all in every detail in every second within his presence, but this pattern is soothing in its implications. Its begins with its initial pattern of agagccttcgtttgccaagtcgcctccaga… onwards to the end before it is refined, reworked, and translated into the first budding peptides of lactoferrin that ultimately well up, collect, and bead like translucent pearls of misery to dribble down his face as he begins to cry. I continued to stare at him of course, and I continued to collect my records, my data, my observations as he waited for the end to arrive. He expected me to kill him. “You have yet to answer my question.” I stated softly. “I did not come here to butcher you and feed upon your soul like the Tanar’ri and other fiends that you and yours saw fit to summon here, much to your lament.” His sobbing paused and he glanced up at me, suddenly curious in some small manner despite his crushing regret that perfumed the air. His fear was lifting, if only momentarily. “Then why are you here?” He asked. “And what are you? Who are you?” “Because I have come to watch.” I answered him succinctly. “I have come to speak with you. After all, you are responsible for this.” He gazed around once more and gave a sigh of complete and utter resignation. Good. Interesting. Though not verbal he acknowledges his guilt at least to himself. “What I am is of little importance, but I will humor you, my fellow scholar.” I continued. “You may call me Sarkithel fek Parthis, The Chronicler, Gloom Father, Baernaloth…” His brain ignites once again with a spreading synaptic brushfire, patterns of memories accessed and released as he tries to recall even a mention of myself or of my kind. He finds nothing of the sort amid his recollections, though the term of ‘Gloom Father’ strikes some vague, dim detail lurking at the back of his brain. Tempting as it is to snuff that spark before it catches, I allow it to smolder as his heart rate slows, pressure dropping, exocrine glands receiving less and less stimulation, and he grows calm. Good. “I’ve never heard of you before.” He said, worried that failure on his part to know of me might incite rage. Nothing of the sort. Nothing at all of the sort. I sit, legs crossed, book open and perched upon my ankles, pen in hand, calm, exuding cold serenity. Complacence, stoicism, peace, dispassion, tranquility, sang-froid. “Are you a yugoloth?” “In a manner of speaking.” I shrugged. “Perhaps. They might claim so.” Deceipt. Gleeful in misery. Dealing to all parties with the benefit of only themselves. And I was not alone. A single figure stood just within the bounds of the circle. Luck might have smiled upon me then, but the circle was specific, far too specific to bind anything but an Amnizu, it might have even failed to hold other devils of that type except for Izacar himself. A single figure swathed in fine robes, but what hangs in my mind still was a play of opposites that it presented before he even approached and I saw his face. A bestial snarl and the soft swish of silk against silk, the odor of brimstone and the scent of perfume, the wet sound of lips parting in a smile and then a tongue tasting the air like a serpent preparing the strike. The figure strode into the light, moving forwards with an elegant, arrogant swagger before rapping its knuckles against the inside membrane of the binding circle’s wards, knocking upon it like an arcane door, sending ripples across its surface. “Greetings and well met.” The fiend said, stepping into the light of the candles. He was dressed in black robes trimmed with blue silk, a wizard with the head of a maned wolf, clawed hands clasped together at his waist. A well-dressed fiend is still a fiend though, even if he was smiling rather than screaming for blood, even if his claws were polished and engraved, and even if his long mane of ruddy-gray fur was brushed and pulled back, braided together into an elaborate knot with golden wire at his shoulders. The mortal is confusing two separate meetings here with Y’leris, a brief, first meeting alone and a later meeting with many more wizards, and a few more ‘loths present. “Who are you?” I demanded, standing to my feet and pointing a wand at the fiend’s chest. “Y’leris.” He answered. “Though I suppose if you wish to have my full title, that would be Y’leris Ap Gehinnom, 34th scribe of the Abscess of the Hollow Heart. No need to be so formal though, and besides, I’m here with your best interests in mind.” “And I could banish you in a heartbeat.” I replied, not returning his smile. “Tsk tsk tsk…” He chided whimsically. “That would be rash I think, given the predicament you find yourselves in. And one that…” The fiend trailed off to look down at the circle, moving one of his feet and reading the runes carved into the layer of wax that composed the outermost layer of the wards. “And one that Izacar the Bitter probably couldn’t help you with anyways, assuming he wasn’t bound by overriding agreements to not speak with you.” I narrowed my eyes and stared at him. He was right, and he knew it as he grinned. “You’re in a bit of an untenable position,” He said. “But I can help you. My clients that I represent can help you greatly. Shall we talk?” “What exactly are you?” “I am Yugoloth, and we, my kind, are called arcanaloth.” I knew what that implied, but I’d had no firsthand experience with his caste, so I let him explain himself. "We are middlemen, of a sort." The arcanaloth said. "We are involved in the conflict between Tanar'ri and Baatezu, yes, but not in so straightforward a way, and not for either side in particular. Self interest, enlightened or not, is what defines us in many ways." He paused, clasped his hands and stepped forwards into our midst, robes swishing and claws clicking staccato on the stone floor. "We, myself, my clients, we wish to offer you our services." "Who do you serve?" "Interesting question that is..." He said, holding up a clawed index finger and smirking. "In general, or specifically in this case?" "Yes." "In general, myself, as that's all that matters really." And from his perspective he is certainly right. That is his -truth-, that his own self-importance is the overriding factor within the hostile reality he is part of. Everything exists to be taken, used, given pain for his enjoyment simply because he wishes to do so and he can. Truth is that, and on some level it is also a fact, but only by ignorance of the larger whole of universal Evil. He is not ignorant of it though, he embraces it in many ways to give you my -truth-, a self-defining self-delusion, a liar’s lie to himself, a child of the Waste to the end. We are pieces, self-absorbed extensions of the godhead. "And now, in this case, in specific?" He gave a languid smile and paused for dramatic effect, overly dramatic effect. "I am Yugoloth, but in this case I serve as agent and painted little temple ***** to Hethradia, Prince of Demons. My singular/dualistic master would increase his great prestige and personal power by blunting the Baatezu here on this world.” And give itself purpose, give itself focus, give itself clarity amidst the madness and struggle against his self, his other self, a literal house divided. A different creature entirely, but the struggle outwards placates and forestalls the struggle inwards, a similar thing to the little 'loth's focus through dissolution, importance through absence, but Demogorgon has a different Truth "What is the price?" "And therein lies my importance here. Let us talk and discuss your situation and salvation, shall we?" Of course we paid too much, far too much, but as he’d said, our position was rather untenable. We were lost without some form of outside help, and that help was being offered up to us on a silver platter, dressed to our liking, if only we would sign on the proffered page of screaming, bleeding parchment. Deeds, abstinence from the calling and binding of Baatezu for a period of decades, the banning of certain faiths, the oppression of others, the souls of half of those in our forces who fell during the coming slaughter. The terms were dictated in part, and half of them were offered up by our own people who were giving up things that meant nothing to them compared to their own survival, and their own continuance of power and prosperity. The hope of salvation had turned us to greed, and greed had turned us to damning ourselves. I should have banished the fiend in the first place, but he would have just gone to another one of my peers, and they would have committed my sin themselves, taking his hand and welcoming him in to seduce us with words, to deliver us into the hands of his masters. And in the end, we offered them more than they had been asking. And of course the jackal-headed whelps looked at one another, licking their chops hungrily, and agreed “My place in this is done.” Y’leris said. “Arsephlena the Divided will be my replacement in this matter as of three hours from this point. She speaks for the Divided Prince, and will command his forces here. Our forces, yugoloths in service to the demiurge of the Brine Flats, they will answer to an Ultroloth in the service of the Overlord of Carceri, but he will neither speak with, nor consult with you.” I didn’t speak to the fiend as he incanted the words of his exit from our midst, but he had one last parting word to me. And I think he was more right than not. “I suspect that we’ll be seeing one another again at some point though. Direct or indirect, savor what you’ve wrought.” Indirect, as Y’leris has already moved on to other masters, having sold his services to Orcus within an hour of penning his deal on behalf of Demogorgon. He now serves under the nominal authority of Glyphimhor in the fortress of Tcian-Sumere, expanding his studies of necromantic lore in the depths of the Negative Energy plane, and also working to understand the lingering traces and taint of Tenebrous during that being’s occupation of the fortress. This one we will see again in due time, with his allegiances switching with the direction of the wind And now I sit forward to listen more keenly to the mortal, as he begins to talk of the Tanar’ri, and the coming Blood War spillover
Lobsopdoy 08-01-07, 02:22 PM	Shemmy, you cannot yoink your own fiction :P I think of them as betrayers, first and foremost. But the thing to keep in mind is that they don't do it just for betrayal's sake. Everything that they do is for themselves. Yet because of their origins and "biological" makeup, everything that they do ends up furthering the cause of True Evil. Even when they think that they are working only for their benefit, they work to strengthen evil. Obviously they do this in different ways. The low level Merc 'loths are just cannon fodder that take orders for the higher ups, Nycaloths and such. They do end up betraying their buyers a lot, but they don't seem to have much in the way of initiative. Until then, they suck up to whoever happens to be paying the bills.
PunkRockBard 08-04-07, 04:03 AM	i think a prime example is to read the Charon descriptor in the latest Dungeon magazine. Did You have a hand in that, Shemeska?
Dragonwort 08-04-07, 08:18 AM	I've used both the Arcanaloth & Ultraloth in my past campaigns & boy, were they fun. An Arcanaloth is like a diabloic con-man. Selfish, self-absorbed & ruthless. Why tell them what they need to know when you can lie. Promise everything but give nothing. Show them the prize but never let them get it. Arcanalothses are shifty lying berks who know the Dark about everything in the multiverse. Make them snide. witty & devilishly charming when on their good side & the most vile defiler when angered. Ultraloths are different for me. I play them silent, deadly & emotionless. My past groups have encountered them only to discover that a mark has been placed on one of them for assassination. Ultraloths play the finest of shadowy figures to stalk the group & scare the crap out of them. Arcanalothes are still my favorite bad-guys though.
TheOinodaemon 08-04-07, 02:14 PM	They do whats best for them, with their options increasing as they climb higher in the chain of command (as it were). They lack the crassness of demons and the endless beuracracy of the Devils, so they're free to improvise. But their also completely cold, sacrificing thousands (or millons) for their goals means nothing. Keep in mind that Yugolothst got their reputation for treachery in the Blood War. It in the interest of the entire Yugoloth race if the Blood War continues (money, both Devils and Demons need them, etc...)but also the side of good. So I would submit that when a Yugoloth betrays you, you may be in the wrong and they may be acting for the good of the ENTIRE universe. Just judge them to harshly. You were the one in the wrong after all.
Shemeska the Marauder 08-04-07, 06:12 PM	i think a prime example is to read the Charon descriptor in the latest Dungeon magazine. Did You have a hand in that, Shemeska? No, I did not.
PunkRockBard 08-05-07, 12:19 AM	No, I did not. What is Your take on it? i thought it was fairly well done. The CR was too darn low. THe higher up yugoloths..even the lords...still seem to be played as mainly mercenaryish...but overall i think they did a good job. Charon was described as keeping his aboad in Hades. i am glad a lord finally got some stats.
Shemeska the Marauder 08-05-07, 12:45 AM	What is Your take on it? i thought it was fairly well done. The CR was too darn low. THe higher up yugoloths..even the lords...still seem to be played as mainly mercenaryish...but overall i think they did a good job. Charon was described as keeping his aboad in Hades. i am glad a lord finally got some stats. Charon returned to his mythological roots in that he has an arrangement with Hades, perhaps by extension the other members of the Olypian pantheon, to carry the souls of their believers across the Styx to their domains. A bit on the light side of mercenary, till you realize just how dark the situation is, because for every soul he ferries for Hades, he's taking a piece of that soul as payment. I liked the 'Charon is effectively unkillable in any permanent sense so long as the river Styx exists, fed by mortal souls and beliefs' bit. It makes Charon comparatively young among the yugoloth lords, but given his altraloth status that's not a problem and it fits rather nicely. Wolfgang didn't know about Ed Bonny's 'Pox of the Planes' article to reference it in regards to Charon (and he didn't seem happy to have done so when he found out), but they fit together nonetheless. I think he did a really, really nice job with Charon (to say nothing about the rest of the adventure which rocked as well).
PunkRockBard 08-05-07, 12:54 AM	Charon returned to his mythological roots in that he has an arrangement with Hades, perhaps by extension the other members of the Olypian pantheon, to carry the souls of their believers across the Styx to their domains. A bit on the light side of mercenary, till you realize just how dark the situation is, because for every soul he ferries for Hades, he's taking a piece of that soul as payment. I liked the 'Charon is effectively unkillable in any permanent sense so long as the river Styx exists, fed by mortal souls and beliefs' bit. It makes Charon comparatively young among the yugoloth lords, but given his altraloth status that's not a problem and it fits rather nicely. Wolfgang didn't know about Ed Bonny's 'Pox of the Planes' article to reference it in regards to Charon (and he didn't seem happy to have done so when he found out), but they fit together nonetheless. I think he did a really, really nice job with Charon. i completely agree. The connection to Hades bit was wonderful...as far as the 2e article...i don't think it is too much of a loss. Adding flavor is what DND should be about.